Review



in fusion ligation independent cloning kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    TaKaRa in fusion ligation independent cloning kit
    In Fusion Ligation Independent Cloning Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 10117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/In-Fusion+HD+Cloning+Kit/pm33209191__ml0c00272_si_001-85-37-41
    Average 99 stars, based on 10117 article reviews
    in fusion ligation independent cloning kit - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Excitotoxic glutamate levels cause the secretion of resident endoplasmic reticulum proteins
    Article Snippet: .. All plasmids were constructed using ligation-independent cloning (In-Fusion, Clontech) into the backbone of pAAV CaMKII iRFP-FLAG (Addgene 149513) after digestion with NheI and AscI restriction enzymes (New England Biolabs) and insert amplification by polymerase chain reaction. .. All PCR reactions were performed with Q5 polymerase (New England Biolabs) and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel).

    Ligation:

    Article Title: Excitotoxic glutamate levels cause the secretion of resident endoplasmic reticulum proteins
    Article Snippet: .. All plasmids were constructed using ligation-independent cloning (In-Fusion, Clontech) into the backbone of pAAV CaMKII iRFP-FLAG (Addgene 149513) after digestion with NheI and AscI restriction enzymes (New England Biolabs) and insert amplification by polymerase chain reaction. .. All PCR reactions were performed with Q5 polymerase (New England Biolabs) and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel).

    Article Title: Critical role for isoprenoids in apicoplast biogenesis by malaria parasites
    Article Snippet: .. Homology arm regions (411 bp for the 5’ arm and 540 bp for the 3’ arm) were PCR-amplified from genomic DNA with primers 19–22 and cloned into the vector pRS ( ) using ligation-independent cloning (In-Fusion, Clontech, Mountain View, CA). .. A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG ( ) using primers 23 and 24; 75 µg of pRS-miaA-KO plasmid was combined with 75 µg of the pCasG guide RNA plasmid and transfected into NF54 PfMev parasites.

    Article Title: Functional Analysis of FoCrpA in Fusarium oxysporum Causing Rice Seedling Blight
    Article Snippet: .. The plasmid pXEH was linearized with EcoRI, and the upstream fragment was ligated into the EcoRI site via ligation-independent cloning (Takara Bio). ..

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..

    Article Title: Functional Analysis of FoCrpA in Fusarium oxysporum Causing Rice Seedling Blight.
    Article Snippet: .. The plasmid pXEH was linearized with EcoRI, and the upstream fragment was ligated into the EcoRI site via ligation-independent cloning (Takara Bio). ..

    Article Title: Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning
    Article Snippet: Then each intact gRNA expression cassette was amplified by PCR and both were inserted into an AAV expression vector that contained a EGFP-KASH reporter (pOTTC1553, Addgene #131682), resulting in plasmid pOTTC1642 (Addgene #195018). .. All cloning reactions used PCR amplification and ligation-independent cloning (In-Fusion, Takara Inc.). .. Reactions involving non-AAV plasmids were transformed into Stellar competent cells (Takara Inc.) and those involving AAV plasmids were transformed into NEB Stable competent cells (New England Biolabs).

    Cloning:

    Article Title: Excitotoxic glutamate levels cause the secretion of resident endoplasmic reticulum proteins
    Article Snippet: .. All plasmids were constructed using ligation-independent cloning (In-Fusion, Clontech) into the backbone of pAAV CaMKII iRFP-FLAG (Addgene 149513) after digestion with NheI and AscI restriction enzymes (New England Biolabs) and insert amplification by polymerase chain reaction. .. All PCR reactions were performed with Q5 polymerase (New England Biolabs) and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel).

    Article Title: Critical role for isoprenoids in apicoplast biogenesis by malaria parasites
    Article Snippet: .. Homology arm regions (411 bp for the 5’ arm and 540 bp for the 3’ arm) were PCR-amplified from genomic DNA with primers 19–22 and cloned into the vector pRS ( ) using ligation-independent cloning (In-Fusion, Clontech, Mountain View, CA). .. A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG ( ) using primers 23 and 24; 75 µg of pRS-miaA-KO plasmid was combined with 75 µg of the pCasG guide RNA plasmid and transfected into NF54 PfMev parasites.

    Article Title: Functional Analysis of FoCrpA in Fusarium oxysporum Causing Rice Seedling Blight
    Article Snippet: .. The plasmid pXEH was linearized with EcoRI, and the upstream fragment was ligated into the EcoRI site via ligation-independent cloning (Takara Bio). ..

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..

    Article Title: Functional Analysis of FoCrpA in Fusarium oxysporum Causing Rice Seedling Blight.
    Article Snippet: .. The plasmid pXEH was linearized with EcoRI, and the upstream fragment was ligated into the EcoRI site via ligation-independent cloning (Takara Bio). ..

    Article Title: Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning
    Article Snippet: Then each intact gRNA expression cassette was amplified by PCR and both were inserted into an AAV expression vector that contained a EGFP-KASH reporter (pOTTC1553, Addgene #131682), resulting in plasmid pOTTC1642 (Addgene #195018). .. All cloning reactions used PCR amplification and ligation-independent cloning (In-Fusion, Takara Inc.). .. Reactions involving non-AAV plasmids were transformed into Stellar competent cells (Takara Inc.) and those involving AAV plasmids were transformed into NEB Stable competent cells (New England Biolabs).

    Amplification:

    Article Title: Excitotoxic glutamate levels cause the secretion of resident endoplasmic reticulum proteins
    Article Snippet: .. All plasmids were constructed using ligation-independent cloning (In-Fusion, Clontech) into the backbone of pAAV CaMKII iRFP-FLAG (Addgene 149513) after digestion with NheI and AscI restriction enzymes (New England Biolabs) and insert amplification by polymerase chain reaction. .. All PCR reactions were performed with Q5 polymerase (New England Biolabs) and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel).

    Article Title: Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning
    Article Snippet: Then each intact gRNA expression cassette was amplified by PCR and both were inserted into an AAV expression vector that contained a EGFP-KASH reporter (pOTTC1553, Addgene #131682), resulting in plasmid pOTTC1642 (Addgene #195018). .. All cloning reactions used PCR amplification and ligation-independent cloning (In-Fusion, Takara Inc.). .. Reactions involving non-AAV plasmids were transformed into Stellar competent cells (Takara Inc.) and those involving AAV plasmids were transformed into NEB Stable competent cells (New England Biolabs).

    Polymerase Chain Reaction:

    Article Title: Excitotoxic glutamate levels cause the secretion of resident endoplasmic reticulum proteins
    Article Snippet: .. All plasmids were constructed using ligation-independent cloning (In-Fusion, Clontech) into the backbone of pAAV CaMKII iRFP-FLAG (Addgene 149513) after digestion with NheI and AscI restriction enzymes (New England Biolabs) and insert amplification by polymerase chain reaction. .. All PCR reactions were performed with Q5 polymerase (New England Biolabs) and cleaned up using Nucleospin Gel and PCR spin columns (Macherey-Nagel).

    Article Title: Critical role for isoprenoids in apicoplast biogenesis by malaria parasites
    Article Snippet: .. Homology arm regions (411 bp for the 5’ arm and 540 bp for the 3’ arm) were PCR-amplified from genomic DNA with primers 19–22 and cloned into the vector pRS ( ) using ligation-independent cloning (In-Fusion, Clontech, Mountain View, CA). .. A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG ( ) using primers 23 and 24; 75 µg of pRS-miaA-KO plasmid was combined with 75 µg of the pCasG guide RNA plasmid and transfected into NF54 PfMev parasites.

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..

    Article Title: Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning
    Article Snippet: Then each intact gRNA expression cassette was amplified by PCR and both were inserted into an AAV expression vector that contained a EGFP-KASH reporter (pOTTC1553, Addgene #131682), resulting in plasmid pOTTC1642 (Addgene #195018). .. All cloning reactions used PCR amplification and ligation-independent cloning (In-Fusion, Takara Inc.). .. Reactions involving non-AAV plasmids were transformed into Stellar competent cells (Takara Inc.) and those involving AAV plasmids were transformed into NEB Stable competent cells (New England Biolabs).

    Clone Assay:

    Article Title: Critical role for isoprenoids in apicoplast biogenesis by malaria parasites
    Article Snippet: .. Homology arm regions (411 bp for the 5’ arm and 540 bp for the 3’ arm) were PCR-amplified from genomic DNA with primers 19–22 and cloned into the vector pRS ( ) using ligation-independent cloning (In-Fusion, Clontech, Mountain View, CA). .. A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG ( ) using primers 23 and 24; 75 µg of pRS-miaA-KO plasmid was combined with 75 µg of the pCasG guide RNA plasmid and transfected into NF54 PfMev parasites.

    Plasmid Preparation:

    Article Title: Functional Analysis of FoCrpA in Fusarium oxysporum Causing Rice Seedling Blight
    Article Snippet: .. The plasmid pXEH was linearized with EcoRI, and the upstream fragment was ligated into the EcoRI site via ligation-independent cloning (Takara Bio). ..

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..

    Article Title: Functional Analysis of FoCrpA in Fusarium oxysporum Causing Rice Seedling Blight.
    Article Snippet: .. The plasmid pXEH was linearized with EcoRI, and the upstream fragment was ligated into the EcoRI site via ligation-independent cloning (Takara Bio). ..

    Expressing:

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..

    Sequencing:

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..

    Generated:

    Article Title: XFEL and NMR Structures of Francisella Lipoprotein Reveal Conformational Space of Drug Target against Tularemia
    Article Snippet: .. The expression plasmid pRSET-His6-Xa-Flpp3sol (DNASU accession #FtCD00697202), encoding for the protein sequence Flpp3 xtal was generated by ligation-independent cloning (Clontech In-Fusion HD Cloning Plus) of an insert that was PCR-generated from pRSET-FTT1416sol-6xHis ( Zook et al., 2015 ) into BseRI-digested pRSET-C8xHis (DNASU #EvNO00629010). ..



    Similar Products

    99
    New England Biolabs ligation independent cloning
    Ligation Independent Cloning, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/T4+DNA+Polymerase/bio_rxiv__64898__2026__05__07__723518-225-28-31
    Average 99 stars, based on 1 article reviews
    ligation independent cloning - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa in fusion ligation independent cloning kit
    In Fusion Ligation Independent Cloning Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/In-Fusion+HD+Cloning+Kit/pm33209191__ml0c00272_si_001-85-37-41
    Average 99 stars, based on 1 article reviews
    in fusion ligation independent cloning kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Bimake Inc ligation independent cloning
    Ligation Independent Cloning, supplied by Bimake Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/cloning+independent+ligation/pm42247493-218-32-38
    Average 86 stars, based on 1 article reviews
    ligation independent cloning - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher alicator ligation independent cloning and expression system kit #k1251
    Alicator Ligation Independent Cloning And Expression System Kit #K1251, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/alicator+lic+cloning+and+expression+system/pmc12265866-301-20-24
    Average 90 stars, based on 1 article reviews
    alicator ligation independent cloning and expression system kit #k1251 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs ligation independent cloning reaction
    Ligation Independent Cloning Reaction, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/NEBuilder+HiFi+DNA+Assembly+Master+Mix/bio_rxiv__64898__2026__03__29__713301-145-14-17
    Average 99 stars, based on 1 article reviews
    ligation independent cloning reaction - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    94
    Addgene inc ligation independent cloning
    Ligation Independent Cloning, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/pET+His6+MBP+TEV+LIC+cloning+vector+(1M)+(Plasmid+%2329656)/pm40452297-36-18-15
    Average 94 stars, based on 1 article reviews
    ligation independent cloning - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    99
    TaKaRa ligation independent
    Ligation Independent, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/In-Fusion+HD+Cloning+Kit/pm40335414-388-23-28
    Average 99 stars, based on 1 article reviews
    ligation independent - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa ligation independent cloning
    Ligation Independent Cloning, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ligation+independent+cloning/EcoR+I/pmc12028882-70-18-20
    Average 99 stars, based on 1 article reviews
    ligation independent cloning - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results